<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD with MathML3 v1.3 20210610//EN" "https://jats.nlm.nih.gov/publishing/1.3/JATS-journalpublishing1-3-mathml3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="1.3" xml:lang="en">
  <front>
    <journal-meta>
      <journal-id journal-id-type="publisher-id">JBBS</journal-id>
      <journal-title-group>
        <journal-title>Journal of Biotechnology and Biomedical Science</journal-title>
      </journal-title-group>
      <issn pub-type="epub">2576-6694</issn>
      <publisher>
        <publisher-name>Open Access Pub</publisher-name>
        <publisher-loc>United States</publisher-loc>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="publisher-id">JBBS-17-1744</article-id>
      <article-id pub-id-type="doi">10.14302/issn.2576-6694.jbbs-17-1744</article-id>
      <article-categories>
        <subj-group>
          <subject>research-article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Study of VCAM-1 Gene Expression in Normal and Tumoral Tissues in Patients with Colorectal Cancer </article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <name>
            <surname>Mahdiyeh</surname>
            <given-names>Siyasi</given-names>
          </name>
          <xref ref-type="aff" rid="idm1850755444">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid">https://orcid.org/0000-0002-6880-3606</contrib-id><name>
            <surname>Frouzandeh</surname>
            <given-names>Mahjoubi</given-names>
          </name>
          <xref ref-type="aff" rid="idm1850755444">1</xref>
          <xref ref-type="aff" rid="idm1850756164">*</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Bahar</surname>
            <given-names>Mahjoubi</given-names>
          </name>
          <xref ref-type="aff" rid="idm1850755444">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid">https://orcid.org/0000-0002-8718-7431</contrib-id><name>
            <surname>Samira</surname>
            <given-names>Shabani</given-names>
          </name>
          <xref ref-type="aff" rid="idm1850755444">1</xref>
        </contrib>
      </contrib-group>
      <aff id="idm1850755444">
        <label>1</label>
        <addr-line>Department of Clinical Genetics, National Institute of Genetic Engineering and Biotechnology, Tehran, Iran</addr-line>
      </aff>
      <aff id="idm1850756164">
        <label>*</label>
        <addr-line>corresponding author</addr-line>
      </aff>
      <contrib-group>
        <contrib contrib-type="editor">
          <name>
            <surname>Ning</surname>
            <given-names>Shen</given-names>
          </name>
          <xref ref-type="aff" rid="idm1850857036">1</xref>
        </contrib>
      </contrib-group>
      <aff id="idm1850857036">
        <label>1</label>
        <addr-line>Fulcrum Therapeutics</addr-line>
      </aff>
      <author-notes>
        <corresp>
    
    Frouzandeh Mahjoubi , Email: <email>frouz@nigeb.ac.ir</email></corresp>
        <fn fn-type="conflict" id="idm1851424308">
          <p>The authors have declared that no competing interests exist.</p>
        </fn>
      </author-notes>
      <pub-date pub-type="epub" iso-8601-date="2017-11-01">
        <day>01</day>
        <month>11</month>
        <year>2017</year>
      </pub-date>
      <volume>1</volume>
      <issue>1</issue>
      <fpage>19</fpage>
      <lpage>26</lpage>
      <history>
        <date date-type="received">
          <day>22</day>
          <month>08</month>
          <year>2017</year>
        </date>
        <date date-type="accepted">
          <day>16</day>
          <month>10</month>
          <year>2017</year>
        </date>
        <date date-type="online">
          <day>01</day>
          <month>11</month>
          <year>2017</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>© </copyright-statement>
        <copyright-year>2017</copyright-year>
        <copyright-holder>Mahdiyeh Siyasi et al.</copyright-holder>
        <license xlink:href="http://creativecommons.org/licenses/by/4.0/" xlink:type="simple">
          <license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</license-p>
        </license>
      </permissions>
      <self-uri xlink:href="http://openaccesspub.org/jbbs/article/614">This article is available from http://openaccesspub.org/jbbs/article/614</self-uri>
      <abstract>
        <sec id="idm1850593244">
          <title>Aim: </title>
          <p>Colorectal cancer is one of the most commonly diagnosed cancers in the world. Cell adhesion molecules play an important role in the progression of various cancers. It has been shown that the high level expression of some Cell adhesion molecule could be a new diagnostic factor for several cancers.</p>
          <p>Vascular cell adhesion molecule 1 (VCAM1) is a cell surface glycoprotein that is expressed in the endothelium activated by cytokine. Generally, VCAM-1 expression level is very poor in normal adult tissue endothelial cells. According to the above explanation, this study was conducted to investigate the expression of VCAM-1 in tumoral tissues and adjacent normal tissues in Iranian colorectal cancer patients and its relation with clinicopathological Features in patients with cancer.</p>
        </sec>
        <sec id="idm1850592812">
          <title>Methods: </title>
          <p>In this study, 60 tumoral tissues and 39 adjacent normal tumor tissues were evaluated using reverse transcription-polymerase chain reaction (RT-PCR) technique. </p>
        </sec>
        <sec id="idm1850592524">
          <title>Conclusion: </title>
          <p>A significant correlation was found between VCAM-1 expression level and the stage, lymph node involvement, tumor progression factor of cancer and sex. Interestingly, VCAM-1 expression was not observed in tumors with stage 0.  No association was seen between VCAM-1 expression and other clinical features such as age, size of the tumor, metastasis and the number of lymph nodes. These findings suggest that VCAM-1 expression level may reflect disease progression and elevation in VCAM-1 has prognostic significance in patients with colorectal carcinoma. </p>
        </sec>
      </abstract>
            <kwd-group>
        <kwd>Colorectal Cancer</kwd>
        <kwd>Vascular Cell Adhesion Molecule-1 (VCAM-1)</kwd>
        <kwd>Gene Expression</kwd>
        <kwd>Cell Adhesion Molecules</kwd>
        <kwd>Reverse Transcription Polymerase Chain Reaction (RT-PCR)</kwd>
        <kwd>Biomarker</kwd>
      </kwd-group>
      <counts>
        <fig-count count="1"/>
        <table-count count="2"/>
        <page-count count="8"/>
      </counts>
    </article-meta>
  </front>
  <body>
    <sec id="idm1850592236" sec-type="intro">
      <title>Introduction</title>
      <p>Colorectal cancer is the third most common cancer in the world with nearly 1.4 million new cases diagnosed in 2013<xref ref-type="bibr" rid="ridm1853330916">1</xref>.The same report shows that CRC in Iran between 2000 and 2009 has a  five-year survival rate between 43 and 49 percent. CRC is normally a disease of aged people occurring in individuals over 65 years<xref ref-type="bibr" rid="ridm1853371940">2</xref>. The relatively poor prognosis for colorectal cancer is due largely to the advanced stage of disease at the time of diagnosis. Therefore, early diagnosis is particularly important. Adhesion molecules (CAMs) and receptors from different tissues and organs vary and heterogeneity has been recognized in the mechanisms of tumor cell interaction with the endothelium.</p>
      <p> One of the vital organs of the molecule, vascular cell adhesion molecule-1(VCAM-1) is highly conserved throughout evolution. VCAM-1 is an immunoglobulin (Ig)-like adhesion molecule with 7 extracellular Ig domains that are mainly expressed in endothelial cells <xref ref-type="bibr" rid="ridm1853832788">3</xref><sup>,</sup><xref ref-type="bibr" rid="ridm1853392972">4</xref>. While expressed at a low level on resting endothelial cells, VCAM-1 is strongly induced by several inflammatory cytokines <xref ref-type="bibr" rid="ridm1853191540">5</xref><sup>,</sup><xref ref-type="bibr" rid="ridm1853186396">6</xref>. Thus, VCAM-1 is a widely distributed protein. VCAM-1 acts in recognition of cell to cell, adhesion of endothelial cells-leukocytes, signal transmission, regulation of migration of leukocytes across the blood vessel wall and creating attachment points for the development of the endothelium during angiogenesis <xref ref-type="bibr" rid="ridm1853182596">7</xref>. It is possible that VCAM-1 is a candidate for mediating tumor cell adhesion to vascular endothelial cells and promoting the metastatic process. Recent reports have shown that angiogenesis favors tumor growth and facilitates entry of cells into the circulation<xref ref-type="bibr" rid="ridm1853177652">8</xref><sup>,</sup><xref ref-type="bibr" rid="ridm1853173172">9</xref>. VCAM-1 binds with high affinity to the integrin α4β1 (also known as very-late antigen, VLA-4) and α4β7.</p>
    </sec>
    <sec id="idm1850586852" sec-type="materials">
      <title>Material and Method</title>
      <sec id="idm1850586708">
        <title>Patients</title>
        <p>Sixty specimens of colorectal cancer tissues were obtained from patients who underwent surgery at Hazrat Rasool Hospital and Imam Khomeini Hospital. Tumoral tissues and blood samples from patients with colorectal cancer (60) and Adjacent normal tissue as controls from colorectal cancer patients (39) were obtained after subjects provided informed consent <xref ref-type="bibr" rid="ridm1853171372">10</xref>. Tissue samples were frozen and stored at -70 degrees. The pathological information of all patients was obtained from the Pathology Department of Hazrat Rasoll Hospital and Imam Khomeini Hospital. Staging of colorectal cancer was performed according to the International Union against Cancer (UICC) which is based on (AJCC-TNM) classification. They consisted of 29 males and 31 female patients ranging in age from 28 to 81 years. The project was approved by the local ethics committee of the National Institute for Genetic Engineering and Biotechnology (NIGEB).</p>
      </sec>
      <sec id="idm1850586204">
        <title>RNA Extraction and cDNA Synthesis</title>
        <p>   RNA extraction was carried out with the Tripure Isolation Reagent (Roche Applied Sciences). For cDNA synthesis, 1 μg of total RNA from each sample was used to synthesize first-strand cDNA according to the manufacturer’s protocol (Ferments). </p>
      </sec>
      <sec id="idm1850585916">
        <title>RNA Reverse Transcription-PCR</title>
        <p>   Evaluation of the expression level of VCAM-1 was performed by Reverse transcription-polymerase chain reaction (RT–PCR) with a one-step RT–PCR assay kit (Qiagen). The following primers were used for evaluating VCAM-1 expression: VCAM-1 forward 5’-AACCCAAACAAAGGCAGAG- 3’ VCAM-1 reverse 5’-CACAGGATTTTCGGAGCA- 3’.</p>
        <p>GAPDH was selected as the housekeeping gene for assessment of expression. The primer sequences for GAPDH were as follows: forward 5’- GCAGGGGGGAGCCAAAAGGGT -3’ and reverse 5’- TGGGTGGCAGTGATGGCATGG -3’. Each 25-μl reaction mixture contained 5μl of cDNA solution in water, 0.6 μM of each primer (The concentration of primers used in the reaction was equivalent to 5 pM/μM , 6.3 mM water and 12.5 μL of Power SYBR Green PCR Master Mix. Cycle parameters were 94°C for 5 min to activate Taq, followed by 35 cycles of 94°C for 30 sec, 53 °C for 30 sec, and 72°C for 30 sec. Finally, a cooling program cooled the reaction mixture to 40 °C. The products underwent electrophoresis on 2% agarose gel.</p>
      </sec>
    </sec>
    <sec id="idm1850585484">
      <title>Statistical Analysis</title>
      <p>   Statistical analysis was performed using the SPSS software V20. The difference in loss of gene expression VCAM-1 and gene expression VCAM-1 between Tumor and adjacent normal tissue samples in colorectal cancer patients was determined using the chi-square test. A P-value less than 0.05 was considered statistically significant.</p>
    </sec>
    <sec id="idm1850585196" sec-type="results">
      <title>Results</title>
      <sec id="idm1850585052">
        <title>VCAM-1 Expression and Its Relation To Clinicopathologic Parameters</title>
        <p>   Colonic cancer tissue was obtained from 31 female and 29 male patients undergoing surgery for sporadic colon cancer. The characteristics of patients are listed in <xref ref-type="table" rid="idm1851627948">Table 1</xref>.</p>
        <table-wrap id="idm1851627948">
          <label>TABLE 1.</label>
          <caption>
            <title> The characteristics of patients and relationships between expressions of vascular Cell molecule 1 and clinicopathologic factors in 60 colorectal patients</title>
          </caption>
          <table rules="all" frame="box">
            <tbody>
              <tr>
                <td>Variable                                         </td>
                <td> n</td>
                <td> P vaiue(p&lt;0.05)</td>
              </tr>
              <tr>
                <td>Gender</td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td>Male</td>
                <td>29</td>
                <td>0.032*</td>
              </tr>
              <tr>
                <td>Female       </td>
                <td>31</td>
                <td/>
              </tr>
              <tr>
                <td>Age</td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td>≥50</td>
                <td>37</td>
                <td>0.103</td>
              </tr>
              <tr>
                <td>&lt;50</td>
                <td>23</td>
                <td/>
              </tr>
              <tr>
                <td>T classification</td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td>Tx</td>
                <td>4</td>
                <td>0.000*</td>
              </tr>
              <tr>
                <td>T1</td>
                <td>0</td>
                <td/>
              </tr>
              <tr>
                <td>T2</td>
                <td>14</td>
                <td/>
              </tr>
              <tr>
                <td>T3</td>
                <td>34</td>
                <td/>
              </tr>
              <tr>
                <td>T4</td>
                <td>8</td>
                <td/>
              </tr>
              <tr>
                <td>Tumor size</td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td>1.5-3</td>
                <td>16</td>
                <td>0.0419</td>
              </tr>
              <tr>
                <td>3.1-5</td>
                <td>24</td>
                <td/>
              </tr>
              <tr>
                <td>5.6-12</td>
                <td>20</td>
                <td/>
              </tr>
              <tr>
                <td>Lymph node involvement</td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td>N0</td>
                <td>27</td>
                <td>0.073</td>
              </tr>
              <tr>
                <td>N1</td>
                <td>24</td>
                <td/>
              </tr>
              <tr>
                <td>N2</td>
                <td>9</td>
                <td/>
              </tr>
              <tr>
                <td>Lymph node metastasis</td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td>N0</td>
                <td>25</td>
                <td>0.014</td>
              </tr>
              <tr>
                <td>N1&amp;N2</td>
                <td>35</td>
                <td/>
              </tr>
              <tr>
                <td>Distant metastasis</td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td>M0 </td>
                <td>47</td>
                <td>0.276</td>
              </tr>
              <tr>
                <td>M1</td>
                <td>13</td>
                <td/>
              </tr>
              <tr>
                <td>UICC TNM classification</td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td>Stage0</td>
                <td>3</td>
                <td>0.000*</td>
              </tr>
              <tr>
                <td>Stage1</td>
                <td>17</td>
                <td/>
              </tr>
              <tr>
                <td>Stage2</td>
                <td>16</td>
                <td/>
              </tr>
              <tr>
                <td>Stage3</td>
                <td>17</td>
                <td/>
              </tr>
              <tr>
                <td>Stage4</td>
                <td>7</td>
                <td/>
              </tr>
            </tbody>
          </table>
          <table-wrap-foot>
            <fn id="idm1850525604">
              <label/>
              <p>Vascular cell adhesion molecule 1=VCAM-1; UICC= International Union Against Cancer.</p>
            </fn>
          </table-wrap-foot>
        </table-wrap>
        <p>The average age of the patients was 50. Patients with average age older than 50 years were 61% (n=37) and average age of patients younger than 50 years were 38% (n=23). There was no significant correlation between VCAM-1 expression level and age (P=0.103).</p>
        <p>According to stages of the colorectal cancer that were histologically diagnosed, study of VCAM-1 expression in stage0 (n=3)5%, stage1 (n=17)28%, stage2 (n=16)26%, stage 3(n=17)28% and stage4 (n=7)12% of the patients was performed. In the present study data analysis showed that VCAM-1 expression level was correlated with stage of colorectal cancer (P=&lt;0.000*).</p>
        <p> In this study, there was no relation between VCAM-1 expression in colorectal cancer patients and tumor metastasis (than patients with primary tumors and non-metastatic colorectal cancer) (P=0.276).</p>
        <p>The patients were divided into two groups according to tumor progression. The first group was based on the TNM classification. In This Category, VCAM-1 expression with tumor progression in the colon of walls was considerably significant (P=0.000*). Frequency classification of tumor progression included Tx (n=4, 7%), T2 (n=14, 23%), T3 (n=34, 57%) and T4 (n=8, 13%) in these patients, respectively. The second group was based on T1-T2 (n=20, 33%) and T3-T4 (n=40, 67%). The second group also had a significant association between VCAM-1 expression and tumor progression (P=0.003*).</p>
        <p>   Relationship between VCAM-1 expression and clinical risk factors of tumor size was measured in three groups. Most of the patients had tumor size between 1.5-3 cm (n=16) 27%; about 40% (n=24) of the patients had tumor size between 3.1-5, while 33% (n=20) of the remaining patients between 5.6-12 cm. In the present study data analysis showed that VCAM-1 expression level was not correlated with tumor size (p&lt;0/419). Patients with lymph node involvement 58 % (N1&amp;N2, n=35) and patients with non-lymph node involvement 42% (N0, n=25) were examined. Our results revealed that VCAM-1 expression level was correlated with lymph node involvement and non-lymph node involvement of the colorectal cancer (P=0.014*). </p>
      </sec>
      <sec id="idm1850524740">
        <title>Expression of VCAM-1 in Normal Tissue and Tumoral Colon Cancer Tissue</title>
        <p>In this study, VCAM-1 expression level in tumoral tissues (n=60) and adjacent normal tissue (n=39) (at least 5 cm away from the tumor margin) was examined. Expression of VCAM-1 was detected in all the tumoral tissues (100%) and half of the adjacent normal tissues of patients (33%). The expression level of VCAM-1 gene in colorectal cancer specimens and adjacent normal tissues was determined by RT-PCR assay and the final data were standardized against GAPDH mRNA levels in samples. The expression level of VCAM-1 in tumoral tissue was higher than normal (P=0.000*). </p>
        <p>A significant correlation between VCAM-1 expression and age, tumor size, number of lymph nodes involved and metastasis in patients had not been observed, as shown in <xref ref-type="table" rid="idm1851514924">Table 2</xref>.</p>
        <table-wrap id="idm1851514924">
          <label>TABLE 2.</label>
          <caption>
            <title>  Correlation of VCAM-1 Gene Expression with clinicopathologic Characteristics of Patients</title>
          </caption>
          <table rules="all" frame="box">
            <tbody>
              <tr>
                <th colspan="2">
                  <bold>Expression of VCAM-1</bold>
                </th>
              </tr>
              <tr>
                <td>Age</td>
                <td>NS (P&gt;0.05)</td>
              </tr>
              <tr>
                <td>Gender</td>
                <td>S(P&lt;0.05)</td>
              </tr>
              <tr>
                <td>Tumor progression</td>
                <td>S(P&lt;0.05)</td>
              </tr>
              <tr>
                <td> Size of tumor</td>
                <td>NS(P&gt;0.05)</td>
              </tr>
              <tr>
                <td>Lymph node involvement</td>
                <td>S(P&lt;0.05)</td>
              </tr>
              <tr>
                <td>Number of lymph nodes</td>
                <td>NS(P&gt;0.05)</td>
              </tr>
              <tr>
                <td>Stage</td>
                <td>S (P&lt;0.05)</td>
              </tr>
              <tr>
                <td>Metastasis</td>
                <td>NS(P&gt;0.05)</td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
      </sec>
    </sec>
    <sec id="idm1850507100" sec-type="discussion">
      <title>Discussion</title>
      <p>   Since cancer is a progressive and multifactorial disease, despite recent advances in prevention, the clinical outcome of diagnosis and treatment of the disease is far away from expectation yet. Due to the high incidence of colorectal cancer, early diagnosis is highly important <xref ref-type="bibr" rid="ridm1853167900">11</xref>. </p>
      <p>   Vascular cell adhesion molecule -1 (VCAM-1) had been noticed for the first time more than two decades ago as an endothelial cell adhesion receptor, with a key function for the recruitment of leukocytes in a cellular immune response. In the past few years, a growing insight into the molecular understanding of tumor genesity and metastasis of a variety of VCAM-1 functions in cancer have been elucidated. High expressions of vascular cell adhesion molecule-1 associated with several cancers have been reported. That can be used as a diagnostic factor and a new therapeutic target for various cancers. According to the above description, this study was conducted to investigate the relationship between VCAM-1 expression and clinicopathologic features in Iranian patients with colorectal cancer and the introduction of vascular cell adhesion molecule-1 as a potential therapeutic target and a biomarker of disease activity. VCAM-1 is a 90-kDa glycoprotein that contains six or seven immunoglobulin domains and belongs to the immunoglobulin superfamily of adhesion molecules. In principle, this gene as a molecule induction in human umbilical vein endothelial cells was detected which is capable of binding to tumor cell lines and lymphoid. VCAM-1 is constitutively expressed on many different types of endothelial and stromal cells and mediates    In spread to lymph nodes is a common characteristic of carcinomas. It is also a critical factor to determine the next therapies for cancer. VCAM-1 expression was shown to have a significant correlation with lymph node involvement. But correlation between VCAM-1 expression with the number of lymph nodes involved in metastasis was not observed. Okugawa et al. measured tissue concentrations of the sVCAM-1 in tumor and normal mucosa which showed that there is a significant association between expression of vascular involvement and lymph duct <xref ref-type="bibr" rid="ridm1853104716">25</xref> .One of metastasis to other organs in patients with colorectal cancer tumor growth in the intestinal wall and pass it around and invade nearby organs such as the liver. In this study, we found that Semi-quantitative VCAM-1 expression with tumor progression in the colon wall layers (with either grouping) a significant was observed. Relation of VCAM-1 expression with clinical risk factors of tumor size was examined. Statistically significant correlation between VCAM-1 expression and tumor size was not observed in these patients. However, in patients with tumor sizes between 5.6-12 cm VCAM-1 expression was observed in all the patients. Here, it can be stated that any size of colorectal tumors express VCAM-1 gene. But matter how the tumor size is greater VCAM-1 expression in these samples increases. The risk of colorectal cancer increases with advancing age. More than 90% of cases occur in people aged 50 or older. Significant correlation between VCAM-1 expression and the mean age of patients was not observed. Significant correlation between semi-quantitative expressions VCAM-1 with sex was observed in patients. We observed that in all patients female with VCAM-1 expression.</p>
      <fig id="idm1851470044">
        <label>FIGURE 1.</label>
        <caption>
          <title> Comparison of vascular cell adhesion molecule 1 expression (VCAM-1) levels in 99 patients with colorectal cancer. </title>
        </caption>
        <graphic xlink:href="images/image1.jpg" mime-subtype="jpg"><alt-text>FIGURE 1. Comparison of vascular cell adhesion molecule 1 expression (VCAM-1) levels in 99 patients with colorectal cancer.</alt-text></graphic>
      </fig>
      <p>VCAM-1 may be involved in the progression of human colorectal carcinoma. Differentially expressed vascular molecules may influence the functional characteristics of prostate cancer has been reported <xref ref-type="bibr" rid="ridm1853182596">7</xref><sup>, </sup><xref ref-type="bibr" rid="ridm1853147132">15</xref><sup>, </sup><xref ref-type="bibr" rid="ridm1853134268">18</xref><sup>, </sup><xref ref-type="bibr" rid="ridm1853130540">19</xref> .It is therefore conceivable that tumor cells that produce VCAM-1 might play a role in the adhesion of carcinoma cells to endothelium during disease progression. Alexiou <italic>et al</italic> have demonstrated that serum sVCAM-1 reflects tumor progression and metastasis in colorectal cancer <xref ref-type="bibr" rid="ridm1853127876">20</xref>. Kamezaki <italic>et al</italic> have reported that serum sVCAM-1 is extravagating leukocytes and represents new targets in colorectal cancer therapy. In general, an increasing number of studies on a variety of malignant diseases have suggested that VCAM-1 may play a role in the process of adhesion of tumor cells to endothelial cells and Neovascularization. Given that VCAM-1 in all tissues of the tumor and some normal samples expressed as a reliable diagnostic biomarker is not introduced. But if VCAM-1 expression was not observed in the specimens examined, it is likely that Normal or tumor tissue at stage0 is.</p>
      <p>The controversial results which are obtained from several studies show that serum levels of a variety of adhesion molecules, including VCAM-1 in cancer samples compared to normal samples have increased in various cancers <xref ref-type="bibr" rid="ridm1853182596">7</xref><sup>, </sup><xref ref-type="bibr" rid="ridm1853147132">15</xref><sup>, </sup><xref ref-type="bibr" rid="ridm1853101404">26</xref><sup>, </sup><xref ref-type="bibr" rid="ridm1853096516">27</xref>.</p>
      <p>      In conclusion, we report that expression of VCAM-1 is associated with lymph node involvement, lymph node metastasis, clinical stage, tumor progression in the colon wall layers and gender of patients in colorectal cancer. The correlation with clinicopathologic factors including tumor progression, and involvement and metastasis of lymph node, the crucial role of VCAM-1 in cancer cell adhesion and spreading, and blood vessel development and angiogenesis determines.  Since only patients with zero or only one metastatic site were enrolled in this study, further investigation on patients with higher degree metastasis is recommended. </p>
    </sec>
  </body>
  <back>
    <ack>
      <p>   Research supported by NIGEB grants. The authors would like to thank all patients and healthy subjects who willingly participated in this study.</p>
    </ack>
    <ref-list>
      <ref id="ridm1853330916">
        <label>1.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Haggar</surname>
            <given-names>F A</given-names>
          </name>
          <name>
            <surname>Boushey</surname>
            <given-names>R P</given-names>
          </name>
          <article-title>Colorectal cancer epidemiology: incidence, mortality, survival, and risk factors</article-title><source>Clinics in colon and rectal surgery</source><date>
            <year>2009</year>
          </date>
          <volume>22</volume>
          <issue>4</issue>
          <fpage>191</fpage>
        <pub-id pub-id-type="doi">10.1055/s-0029-1242458</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853371940">
        <label>2.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Dolatkhah</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Somi</surname>
            <given-names>M H</given-names>
          </name>
          <name>
            <surname>Bonyadi</surname>
            <given-names>M J</given-names>
          </name>
          <name>
            <surname>Asvadi</surname>
            <given-names>Kermani I</given-names>
          </name>
          <name>
            <surname>Farassati</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>Dastgiri</surname>
            <given-names>S</given-names>
          </name>
          <article-title>Colorectal Cancer in Iran: Molecular Epidemiology and Screening Strategies</article-title>
          <source>Journal of Cancer Epidemiology</source>
          <fpage>2015</fpage>
          <lpage>2015</lpage>
        <pub-id pub-id-type="doi">10.1155/2015/643020</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853832788">
        <label>3.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Vonderheide</surname>
            <given-names>R H</given-names>
          </name>
          <name>
            <surname>Tedder</surname>
            <given-names>T F</given-names>
          </name>
          <name>
            <surname>Springer</surname>
            <given-names>T A</given-names>
          </name>
          <name>
            <surname>Staunton</surname>
            <given-names>D E</given-names>
          </name>
          <article-title>Residues within a conserved amino acid motif of domains 1 and 4 of VCAM-1 are required for binding to VLA-4</article-title><source>The Journal of cell biology</source><date>
            <year>1994</year>
          </date>
          <volume>125</volume>
          <issue>1</issue>
          <fpage>215</fpage>
          <lpage>22</lpage>
        <pub-id pub-id-type="doi">10.1083/jcb.125.1.215</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853392972">
        <label>4.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Cybulsky</surname>
            <given-names>M I</given-names>
          </name>
          <name>
            <surname>Fries</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Williams</surname>
            <given-names>A J</given-names>
          </name>
          <name>
            <surname>Sultan</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Eddy</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Byers</surname>
            <given-names>M</given-names>
          </name>
          <article-title>Gene structure, chromosomal location, and basis for alternative mRNA splicing of the human VCAM1 gene</article-title><source>Proceedings of the National Academy of Sciences</source><date>
            <year>1991</year>
          </date>
          <volume>88</volume>
          <issue>17</issue>
          <fpage>7859</fpage>
          <lpage>63</lpage>
        <pub-id pub-id-type="doi">10.1073/pnas.88.17.7859</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853191540">
        <label>5.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Luster</surname>
            <given-names>A D</given-names>
          </name>
          <name>
            <surname>Alon</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>von</surname>
            <given-names>Andrian UH</given-names>
          </name>
          <article-title>Immune cell migration in inflammation: present and future therapeutic targets</article-title><source>Nature immunology</source><date>
            <year>2005</year>
          </date>
          <volume>6</volume>
          <issue>12</issue>
          <fpage>1182</fpage>
          <lpage>90</lpage>
        <pub-id pub-id-type="doi">10.1038/ni1275</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853186396">
        <label>6.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Osborn</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Hession</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Tizard</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Vassallo</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Luhowskyj</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Chi-Rosso</surname>
            <given-names>G</given-names>
          </name>
          <article-title>Direct expression cloning of vascular cell adhesion molecule 1, a cytokine-induced endothelial protein that binds to lymphocytes</article-title><source>Cell</source><date>
            <year>1989</year>
          </date>
          <volume>59</volume>
          <issue>6</issue>
          <fpage>1203</fpage>
          <lpage>11</lpage>
        <pub-id pub-id-type="doi">10.1016/0092-8674(89)90775-7</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853182596">
        <label>7.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Maurer</surname>
            <given-names>C A</given-names>
          </name>
          <name>
            <surname>Friess</surname>
            <given-names>H</given-names>
          </name>
          <name>
            <surname>Kretschmann</surname>
            <given-names>B</given-names>
          </name>
          <name>
            <surname>Wildi</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Müller</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Graber</surname>
            <given-names>H</given-names>
          </name>
          <article-title>Over‐expression of ICAM‐1, VCAM‐1 and ELAM‐1 might influence tumor progression in colorectal cancer</article-title><source>International journal of cancer</source><date>
            <year>1998</year>
          </date>
          <volume>79</volume>
          <issue>1</issue>
          <fpage>76</fpage>
          <lpage>81</lpage>
        <pub-id pub-id-type="doi">10.1002/(sici)1097-0215(19980220)79:1&lt;76::aid-ijc15&gt;3.0.co;2-f</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853177652">
        <label>8.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Deng</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Liang</surname>
            <given-names>H</given-names>
          </name>
          <name>
            <surname>Sun</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Zhang</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Zhan</surname>
            <given-names>H</given-names>
          </name>
          <name>
            <surname>Wang</surname>
            <given-names>X</given-names>
          </name>
          <article-title>Prognosis of gastric cancer patients with node-negative metastasis following curative resection: outcomes of the survival and recurrence</article-title>
          <date>
            <year>2008</year>
          </date>
          <source>Canadian Journal of Gastroenterology</source>
          <volume>22</volume>
          <issue>10</issue>
          <fpage>835</fpage>
        <pub-id pub-id-type="doi">10.1155/2008/761821</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853173172">
        <label>9.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Lsegan</surname>
            <given-names>M</given-names>
          </name>
          <article-title>New marker of angiogenesis CD105 (endoglin): diagnostic, prognostic and therapeutic role. Radiology and Oncology</article-title>
          <date>
            <year>2005</year>
          </date>
          <fpage>39</fpage>
          <lpage>4</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1853171372">
        <label>10.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Klöppel</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>Rindi</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>Perren</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Komminoth</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Klimstra</surname>
            <given-names>D S</given-names>
          </name>
          <article-title>The ENETS and AJCC/UICC TNM classifications of the neuroendocrine tumors of the gastrointestinal tract and the pancreas: a statement</article-title><source>Virchows Archiv</source><date>
            <year>2010</year>
          </date>
          <volume>456</volume>
          <issue>6</issue>
          <fpage>595</fpage>
          <lpage>7</lpage>
        <pub-id pub-id-type="doi">10.1007/s00428-010-0924-6</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853167900">
        <label>11.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Pourhoseingholi</surname>
            <given-names>M A</given-names>
          </name>
          <article-title>Increased burden of colorectal cancer in Asia</article-title><source>World journal of gastrointestinal oncology</source><date>
            <year>2012</year>
          </date>
          <fpage>4</fpage>
          <lpage>4</lpage>
        <pub-id pub-id-type="doi">10.4251/wjgo.v4.i4.68</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853165380">
        <label>12.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Alexiou</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Karayiannakis</surname>
            <given-names>A J</given-names>
          </name>
          <name>
            <surname>Syrigos</surname>
            <given-names>K N</given-names>
          </name>
          <name>
            <surname>Zbar</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Sekara</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>Michail</surname>
            <given-names>P</given-names>
          </name>
          <article-title>Clinical significance of serum levels of E-selectin, intercellular adhesion molecule-1, and vascular cell adhesion molecule-1 in gastric cancer patients</article-title><source>The American journal of gastroenterology</source><date>
            <year>2003</year>
          </date>
          <volume>98</volume>
          <issue>2</issue>
          <fpage>478</fpage>
          <lpage>85</lpage>
        <pub-id pub-id-type="doi">10.1111/j.1572-0241.2003.07259.x</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853152820">
        <label>13.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Klemke</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Weschenfelder</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Konstandin</surname>
            <given-names>M H</given-names>
          </name>
          <name>
            <surname>Samstag</surname>
            <given-names>Y</given-names>
          </name>
          <article-title>High affinity interaction of integrin α4β1 (VLA‐4) and vascular cell adhesion molecule 1 (VCAM‐1) enhances migration of human melanoma cells across activated endothelial cell layers</article-title><source>Journal of cellular physiology</source><date>
            <year>2007</year>
          </date>
          <volume>212</volume>
          <issue>2</issue>
          <fpage>368</fpage>
          <lpage>74</lpage>
        <pub-id pub-id-type="doi">10.1002/jcp.21029</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853149364">
        <label>14.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Wu</surname>
            <given-names>T</given-names>
          </name>
          <article-title>The role of vascular cell adhesion molecule-1 in tumor immune evasion</article-title><source>Cancer research</source><date>
            <year>2007</year>
          </date>
          <volume>67</volume>
          <issue>13</issue>
          <fpage>6003</fpage>
          <lpage>6</lpage>
        <pub-id pub-id-type="doi">10.1158/0008-5472.can-07-1543</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853147132">
        <label>15.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Okugawa</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Miki</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Toiyama</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Koike</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Inoue</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Kusunoki</surname>
            <given-names>M</given-names>
          </name>
          <article-title>Serum level of soluble vascular cell adhesion molecule 1 is a valuable prognostic marker in colorectal carcinoma. Diseases of the Colon &amp; Rectum</article-title>
          <date>
            <year>2009</year>
          </date>
          <volume>52</volume>
          <issue>7</issue>
          <fpage>1330</fpage>
          <lpage>6</lpage>
        <pub-id pub-id-type="doi">10.1007/dcr.0b013e3181a0d144</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853143820">
        <label>16.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Byrne</surname>
            <given-names>G J</given-names>
          </name>
          <name>
            <surname>Ghellal</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Iddon</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Blann</surname>
            <given-names>A D</given-names>
          </name>
          <name>
            <surname>Venizelos</surname>
            <given-names>V</given-names>
          </name>
          <name>
            <surname>Kumar</surname>
            <given-names>S</given-names>
          </name>
          <article-title>Serum soluble vascular cell adhesion molecule-1: role as a surrogate marker of angiogenesis</article-title>
          <date>
            <year>2000</year>
          </date>
          <source>Journal of thenationalcancerinstitute</source>
          <volume>92</volume>
          <issue>16</issue>
          <fpage>1329</fpage>
          <lpage>36</lpage>
        <pub-id pub-id-type="doi">10.1093/jnci/92.16.1329</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853137364">
        <label>17.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Fukushi</surname>
            <given-names>J-i</given-names>
          </name>
          <name>
            <surname>Ono</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Morikawa</surname>
            <given-names>W</given-names>
          </name>
          <name>
            <surname>Iwamoto</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Kuwano</surname>
            <given-names>M</given-names>
          </name>
          <article-title>The activity of soluble VCAM-1 in angiogenesis stimulated by IL-4 and IL-13</article-title><source>The Journal of Immunology</source><date>
            <year>2000</year>
          </date>
          <volume>165</volume>
          <issue>5</issue>
          <fpage>2818</fpage>
          <lpage>23</lpage>
        <pub-id pub-id-type="doi">10.4049/jimmunol.165.5.2818</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853134268">
        <label>18.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Slack-Davis</surname>
            <given-names>J K</given-names>
          </name>
          <name>
            <surname>Atkins</surname>
            <given-names>K A</given-names>
          </name>
          <name>
            <surname>Harrer</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Hershey</surname>
            <given-names>E D</given-names>
          </name>
          <name>
            <surname>Conaway</surname>
            <given-names>M</given-names>
          </name>
          <article-title>Vascular cell adhesion molecule-1 is a regulator of ovarian cancer peritoneal metastasis</article-title><source>Cancer research</source><date>
            <year>2009</year>
          </date>
          <volume>69</volume>
          <issue>4</issue>
          <fpage>1469</fpage>
          <lpage>76</lpage>
        <pub-id pub-id-type="doi">10.1158/0008-5472.can-08-2678</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853130540">
        <label>19.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Christiansen</surname>
            <given-names>I</given-names>
          </name>
          <name>
            <surname>Sundström</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Tötterman</surname>
            <given-names>T H</given-names>
          </name>
          <article-title>Elevated serum levels of soluble vascular cell adhesion molecule‐1 (sVCAM‐1) closely reflect tumour burden in chronic B‐lymphocytic leukaemia</article-title><source>British journal of haematology</source><date>
            <year>1998</year>
          </date>
          <volume>103</volume>
          <issue>4</issue>
          <fpage>1129</fpage>
          <lpage>37</lpage>
        <pub-id pub-id-type="doi">10.1046/j.1365-2141.1998.01110.x</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853127876">
        <label>20.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Alexiou</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Karayiannakis</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Syrigos</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Zbar</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Kremmyda</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Bramis</surname>
            <given-names>I</given-names>
          </name>
          <article-title>Serum levels of E-selectin, ICAM-1 and VCAM-1 in colorectal cancer patients: correlations with clinicopathological features, patient survival and tumour surgery</article-title>
          <date>
            <year>2001</year>
          </date>
          <source>European Journal of Cancer</source>
          <volume>37</volume>
          <issue>18</issue>
          <fpage>2392</fpage>
          <lpage>7</lpage>
        <pub-id pub-id-type="doi">10.1016/s0959-8049(01)00318-5</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853124348">
        <label>21.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Banner</surname>
            <given-names>B F</given-names>
          </name>
          <name>
            <surname>Savas</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Woda</surname>
            <given-names>B A</given-names>
          </name>
          <article-title>Expression of adhesion molecules in the host response to colon carcinoma</article-title><source>Ultrastructural pathology</source><date>
            <year>1995</year>
          </date>
          <volume>19</volume>
          <issue>2</issue>
          <fpage>113</fpage>
          <lpage>8</lpage>
        <pub-id pub-id-type="doi">10.3109/01913129509014611</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853116884">
        <label>22.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Velikova</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>Banks</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Gearing</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Hemingway</surname>
            <given-names>I</given-names>
          </name>
          <name>
            <surname>Forbes</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Preston</surname>
            <given-names>S</given-names>
          </name>
          <article-title>Serum concentrations of soluble adhesion molecules in patients with colorectal cancer</article-title><source>British journal of cancer</source><date>
            <year>1998</year>
          </date>
          <volume>77</volume>
          <issue>11</issue>
          <fpage>1857</fpage>
        <pub-id pub-id-type="doi">10.1038/bjc.1998.309</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853113572">
        <label>23.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Lu</surname>
            <given-names>X</given-names>
          </name>
          <name>
            <surname>Mu</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>Wei</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Riethdorf</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Yang</surname>
            <given-names>Q</given-names>
          </name>
          <name>
            <surname>Yuan</surname>
            <given-names>M</given-names>
          </name>
          <article-title>VCAM-1 promotes osteolytic expansion of indolent bone micrometastasis of breast cancer by engaging α4β1-positive osteoclast progenitors</article-title><source>Cancer cell</source><date>
            <year>2011</year>
          </date>
          <volume>20</volume>
          <issue>6</issue>
          <fpage>701</fpage>
          <lpage>14</lpage>
        <pub-id pub-id-type="doi">10.1016/j.ccr.2011.11.002</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853110260">
        <label>24.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Kemik</surname>
            <given-names>O</given-names>
          </name>
          <name>
            <surname>Kemik</surname>
            <given-names>A S</given-names>
          </name>
          <name>
            <surname>Hasirci</surname>
            <given-names>I</given-names>
          </name>
          <name>
            <surname>Adas</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Purisa</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Dulger</surname>
            <given-names>A</given-names>
          </name>
          <article-title>Serum level of soluble vascular adhesion molecule 1 in patients with rectal cancer</article-title>
          <source>Eur J Gen Med</source>
          <volume>8</volume>
          <issue>2</issue>
          <fpage>105</fpage>
          <lpage>9</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1853104716">
        <label>25.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Okugawa</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Miki</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Toiyama</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Koike</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Yokoe</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Saigusa</surname>
            <given-names>S</given-names>
          </name>
          <article-title>Soluble VCAM-1 and its relation to disease progression in colorectal carcinoma</article-title><source>Experimental and Therapeutic Medicine</source><date>
            <year>2010</year>
          </date>
          <volume>1</volume>
          <issue>3</issue>
          <fpage>463</fpage>
          <lpage>9</lpage>
        <pub-id pub-id-type="doi">10.3892/etm_00000072</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1853101404">
        <label>26.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Kumara</surname>
            <given-names>H S</given-names>
          </name>
          <name>
            <surname>Tohme</surname>
            <given-names>S T</given-names>
          </name>
          <name>
            <surname>Herath</surname>
            <given-names>S A</given-names>
          </name>
          <name>
            <surname>Yan</surname>
            <given-names>X</given-names>
          </name>
          <name>
            <surname>Senagore</surname>
            <given-names>A J</given-names>
          </name>
          <name>
            <surname>Nasar</surname>
            <given-names>A</given-names>
          </name>
          <article-title>Plasma soluble vascular adhesion molecule-1 levels are persistently elevated during the first month after colorectal cancer resection. Surgical endoscopy</article-title>
          <date>
            <year>2012</year>
          </date>
          <volume>26</volume>
          <issue>6</issue>
          <fpage>1759</fpage>
          <lpage>64</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1853096516">
        <label>27.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Tas</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>Karabulut</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Serilmez</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Ciftci</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Duranyildiz</surname>
            <given-names>D</given-names>
          </name>
          <article-title>Clinical significance of serum epithelial cell adhesion molecule (EPCAM) and vascular cell adhesion molecule-1 (VCAM-1) levels in patients with epithelial ovarian cancer. Tumor Biology</article-title>
          <date>
            <year>2014</year>
          </date>
          <volume>35</volume>
          <issue>4</issue>
          <fpage>3095</fpage>
          <lpage>102</lpage>
        <pub-id pub-id-type="doi">10.1200/jco.2014.32.15_suppl.e22192</pub-id></mixed-citation>
      </ref>
    </ref-list>
  </back>
</article>